Skip to main content

Table 1 Primers used for the amplification of the respective genes in the real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR)

From: Toxicological effects of the concurrent administration of cadmium and arsenic through the food chain on the liver and kidney of rats

GenePrimer
GAPDHF: GGCTCTCTGCTCCTCCCTGTTCTA
R: TGCCGTTGAACTTGCCGTGG
Bcl2F: CTG GTG GAC AAC ATC GCT CTG
R: GGT CTG CTG ACC TCA CTT GTG
BaxF: TTCATC CAGGAT CGA GCA GA
R: GCA AAG TAG AAG GCA ACG