Skip to main content

Table 1 The gene-specific primers used for RT-PCR

From: Dandelion prevents liver fibrosis, inflammatory response, and oxidative stress in rats

Gene name Primer sequence 5′-3′ Gene bank accession number
TNF-α F: AACTCGAGTGACAAGCCCGTAG
R: GTACCACCAGTTGGTTGTCTTTGA
NM_012675.3
NF-kB F: CATTGAGGTGTATTTCACGG
R: GAACACAATGGCCACTTGCC
NM_199267.2
IL-1β F: GCTGTGGCAGCTACCTATGTCTTG
R: AGGTCGTCATCATCCCACGAG
NM_031512.2
COX-2 F: ACTTGCTCACTTTGTTTCATTC
R: TTTGATTAGTACTGTAGGGTTAATG
S67722.1
TGF-β F: TGCGCCTGCAGAGATTCAAG
R: AGGTAACGCCAGGAATTGTTGCTA
NM_021578.2
α-SMA F: ACCAACTGGGACGACATGGAG
R: CGTGAGGATCTTCATGAGGTAGTC
NM_031004.2
Colla1 F: GAACTTGGGGCAAGACAGTCA
R: GTCACGTTCAGTTGGTCAA
NM_053304.1
Colla3 F: TTGATGTGCAGCTGGCATTC
R: GCCACTGGCCTGATCCATAT
NM_009930
GAPDH F: CCCCTTCATTGACCTCAACTACATGG
R: GCCTGCTTCACCACCTTCTTGATGTC
NM_017008.4