Skip to main content

Table 1 Primers for the detection of mesenchymal stem cells markers

From: Derivation, characterization, and in vitro cell regeneration of canine white adipose tissue-derived mesenchymal stem cells obtained from a mesenteric region

Primer Forward Reverse
CD45 GGCAAACATGTGAGGACAGA TCCAGATCAAAATTTCCACGA
CD73 CCAGCAGTTGAAGGTCGGAT CCATCACCAAGCCAGTTCCT
CD90 CGTGATCTATGGCACTGTGG TATGCCCTCACACTTGACCA
CD105 AAAACAGACTCACCCAGCCC TGGGGTCTCCATGTGACAGT
NANOG GGTGTCCTACAGCAATCCAC CAGCCAACGCTACTGAAACC
OCT4 GAGTGAGAGGCAACCTGGAG GTGAAGTGAGGGCTCCCATA
SOX2 AGTCTCCAAGCGACGAAAAA GCAAGAAGCCTCTCCTTGAA
Osteopontin TGAAAAGTGCGAGTATGGAA TCAGAATTTTCCTGGCTACC
COL1A1 GAGAGAGGTGAACAAGGTC ACCCTTAGCACCATCATTG
Aggrecan GGCATTGTGTTCCATTACAG CTCATCCTTGTCTCCATAGC
SOX9 AACGCCTTCATGGTGTG GTACTTGTAATCCGGGTGG
Leptin TGACGACTGTTTACTGGGGC GTTTGGGTGAGCCAGTCAGA
FABP4 TGTGCTGGATCTTTCTTACTCA GGTATGAAGTGGCAGGGCTT
GAPDH AACATCATCCCTGCTTCCAC GACCACCTGGTCCTCAGTGT