Alternaria alternata as emerging threat for Hoplobatrachus tigerinus and Phrynoderma hexadactylum in southern West Bengal, India

Abstract

Background

Amphibians are facing a global decline for the last few decades due to habitat loss, pesticide pollution, diseases and some other reasons. Fungal disease called chytridiomycosis has been emerged as one of the major causes of anuran extinction and decline in many parts of the globe. As the causal fungi Batrachochytrium dendrobatidis (Bd) were reported to have ubiquitous distribution on Earth, a survey was being conducted in districts of southern West Bengal, India, to assess probable anuran damage by the Bd in this region. A significant percentage of the common frogs Hoplobatrachus tigerinus and Phrynoderma hexadactylum were found to carry disease symptoms like redness of ventral skin, rashes, skin lesions, sluggish movements followed by death within 2 months.

Results

Investigation pointed the causal factor as Alternaria alternata. Liver and lungs were the primarily affected organs. Histopathology identified the presence of spores in TS of infected lungs along with hepatocellular steatosis. Elevation of serum SGPT and triglyceride (~ tenfold and ~ threefold, respectively, compared to healthy groups) was also key findings in infected individuals. Infection prevalence was highest in South 24 Parganas (more than 7%).

Conclusion

A common plant pathogen shifting host to anurans in a trans-kingdom way may be a significant evolutionary finding, but the infection being detrimental to two local frogs will have severe impacts. As the frogs are food web intermediates of their habitats, a collapse in local food web will be the primary ecological impact along with higher incidence of mosquito-borne diseases.

Background

Anurans remained major ecosystem service providers, as secondary producers with high profitability as well as keeping top-down effects on insect population growth. Such effect is extremely important for human civilization, since they control pests and arbo-vectors by consuming them and protecting us from economical as well as health problems. For centuries, anuran bioactive components from their various body parts are being used in ethno-pharmacology to treat infections, pain, allergies, cardiac diseases, inflammation, cancer and AIDS (Rodriguez et al., 2017). These anurans are declining globally for the last few decades rising a major concern for the ecosystems throughout (Alfred & Richards, 1999, Hero & Morrison, 2004). Along with the other notable causes like over-exploitation, habitat loss, pollution and global climatic change, a significantly increased extinction risk has come under the heading of disease (Table 1), of which chytridiomycosis emerged as the major killer one.

Table 1 Causal factor types that contributed in global anuran decline

To review the global extinction risks of all amphibians, IUCN initiated “Global Amphibian Assessment (GAA)” from 2001 to 2004 followed by GAA2 in 2015, which still has covered only less than 25% assessment in Indian subcontinent (Fisher & Garner, 2020). As per the checklist of amphibians released by Zoological Survey of India in 2020, 17% of Indian amphibians has fallen under IUCN “Threatened” categories, while 19% remained “Data Deficient” and a shockingly large amount of 39% are yet to be evaluated (Dinesh et al., 2020). Thus, the extinction risks of 58% of Indian amphibians remain to be evaluated, which is definitely a very big proportion of them. For the last few decades, Chytridiomycosis, the fungal disease caused by Batrachochytrium dendrobatidis (Bd), leads to severe decline as well as extinction of many amphibians throughout the globe (De Lucca, 2007). Though report regarding prevalence of chytridiomycosis is scanty in the Indian subcontinent, enigmatic decline remains an issue. As part of disease prevalence survey in the southern West Bengal by the present authors, it was observed that the common frogs Hoplobatrachus tigerinus and Phrynoderma hexadactylum were found to carry some disease symptoms.

Individuals having such symptoms were dying within months. Therefore, a thorough investigation was initiated in different regions for disease prevalence and isolation of causal microbial agent(s). The main objectives of our present study include analysis of disease symptoms, isolation and purification of the pathogen, confirmation of pathogen by Koch postulates, histopathological study and phenotypical and molecular identification of the isolated pathogen.

Methods

Ethics and permissions

No wildlife conservation demarcated areas were selected for sampling and/or survey. All the animal related works were approved by the Institutional Animal Ethics Committee of Ramakrishna Mission Vivekananda Centenary College vide approval no. RKMVCC/IAEC/2020-21/AC/004 dated 30.03.2021.

Study areas and sampling

Eleven spots were surveyed as frog sampling sites from 5 districts of southern West Bengal, namely Howrah, Nadia, North 24 Parganas, South 24 Parganas and East Midnapore. The geographical information of the sampling places is represented in Fig. 1. Geographical locations were recorded using Garmin GPS 78S. Frogs were screened for any observable disease symptoms, and disease incidence was calculated as percentage of the diseased frog found over total sampled frogs of each region. Dead and diseased frogs were always evaluated aseptically and carried back to the laboratory separately as and when required. The symptoms were compared following the established guidelines (Ouellet et al., 1997; Aguirre et al., 2002).

Fig. 1

Map of Southern West Bengal (India) demarcating the sampling sites in various districts including of Nadia, North 24 Parganas, South 24 Parganas, Howrah and East Midnapore. The primary map was taken from the website “https://d-maps.com/carte.php?num_car=31185&lang=en#google_vignette”. Latitude and Longitude data were recorded using Garmin GPS 78S

Water quality analyses of sampling sites

Water samples from the habitat water bodies of H tigerinus and P hexadactylum were collected in sterile glass bottles. Temperature and pH were measured using HANNA instrument (Model No. HI98130). Phosphate and nitrate levels were measured following the methods described by Grasshoff et al. (2009). Chlorophyll-a concentration was measured following the protocol described elsewhere (Parsons et al., 1984). “Trophic State Index” of the sampled waterbodies were calculated following the “Water Quality Assessment Report of Florida State”, section 305(B) (Paulic, 1996).

Animals and their maintenance

Adult individuals of both sexes of Hoplobatrachus tigerinus and Phrynoderma hexadactylum were sampled from the natural habitats and screened for disease symptoms. Healthy as well as diseased frogs of both species were separately maintained in large aquatic tanks (200 L of size) simulating their natural habitats. Animals were fed with their natural food ad libitum.

Fungal culture and maintenance

Culture of Alternaria alternata was made in potato dextrose agar (PDA) or potato dextrose broth (PDB) containing streptomycin sulphate (50 mg/L) as and when required following the standard protocols (United States Pharmacopeial Convention, 1984; Murray, 2007; Isenberg, 1992). Monosporic culture methods were then used to produce pure cultures for further use (Huang et al., 2021).

Isolation and identification of fungus from infected Frogs

Dying frogs with disease symptoms were killed. Specific portions of their skin with lesions were cut out. The diseased part of the frog skin aseptically rinsed in 10 ml of double distilled deionised water and kept as stock for serial dilutions. Serial dilutions were made in log dilution procedure from 10⁻¹ to 10⁻⁵ and were named as SD1 to SD5, respectively. Then, 50 µl of each diluted solution was poured into the culture plate, containing potato dextrose agar (PDA) with 0.05% rose bengal and streptomycin sulphate (50 mg/L) and maintained at 25 ± 2 °C for 72 h with 12 h light/12 h dark cycles for optimal sporulation. Each colony grown from the SD groups was isolated, and further pure culture was made in PDA plates, under the same conditions. Morphological characterizations, like length, breath and number of septa, etc., of conidia were done using stereo microscope (Leica EZ4E) and compound microscope (Leica DM750, fitted with Leica ICC50 W camera), and species identification was done following earlier reports (Ellis, 1971, 1976; Lawrence et al., 2016; Simmons, 1992; Simmons & Roberts, 1993).

Molecular identification of fungus

Fungal DNA was isolated following the protocol described elsewhere (Allen et al., 2006). ITS (ITS1 and ITS4) gene primers specific to A. alternata were used for PCR amplification. Primer sequences for ITSs were F- 5’ TCCGTAGGTGAACCTGCGG 3’ and R- 5’ TCCTCCGCTTATTGATATGC 3’ (Konstantinova et al., 2002). Reaction mixture was of 25 µl containing 12.5 µl of 2 × reaction buffer [(100 mm Tris–HCl pH 8.3, 15 mm MgCl₂, 200 µm of each deoxyribonucleotide triphosphate (dNTPs) and 0.5 units of Taq Polymerase (Promega, USA)], 2 µm final concentration of each primer and 20 ng DNA template. PCR was performed in a thermal cycler T-100 (BioRad, USA) with cycling conditions involved initial denaturation at 94 °C for 5 min, then denaturation 94 °C for 1 min, annealing at 57 °C for 1 min, extension at 72 °C for 1 min for 35 cycles and a final extension at 72 °C for 5 min. Reaction mixture was of 25 µl containing 12.5 µl of 2 × reaction buffer [(100 mm Tris–HCl pH 8.3, 15 mm MgCl₂, 200 µm of each deoxyribonucleotide triphosphate (dNTPs) and 0.5 units of Taq Polymerase (Promega, USA)], 2 µm final concentration of each primer and 20 ng DNA template. PCR was performed in a thermal cycler T-100 (BioRad, USA) with cycling conditions involved initial denaturation at 94 °C for 5 min, then denaturation 94 °C for 1 min, annealing at 60 °C for 1 min, extension at 72 °C for 1 min for 35 cycles and a final extension at 72 °C for 5 min.

DNA sequencing of the PCR product was outsourced. PCR product was subjected to DNA sequencing by dideoxy chain termination method (Sanger sequencing) using an automated 3730xl DNA Analyzer (HITACHI made) with upgraded solid-state laser with 96-capillary. The sequence has been deposited to GenBank (NCBI).

Validation of Koch’s postulate

To validate the Koch’s postulates (Gentry et al., 2021; Segre, 2013) of infectious agent aetiology, scoops of 10 mm diameter were cut from each pure culture of fungal plates and transferred to sterilized tubes containing 100 ml sterile water. Adult healthy individuals of both Hoplobatrachus tigerinus (n = 10) and Phrynoderma hexadactylum (n = 10) without any disease symptoms were maintained in the simulated habitats for 3 weeks prior to experiment. Each group of healthy animals was then exposed to A. alternata spores at an effective concentration of 1 × 10⁸/Litre of swimming water following the protocols of Paschapur et al. (2022) with necessary modifications. Animals were evaluated for disease symptoms after 10 days.

Histopathology

Paraffinized tissue sections were prepared as per standard histological practice (Robert et al., 2005). Deparaffinization was done using xylene, following which graded ethyl alcohol rehydration and standard haematoxylin–eosin staining were done.

Clinical biochemistry

Blood was collected by cardiac puncture, and serum was separated. Total protein, serum albumin, serum triglyceride and SGPT were measured using commercially available Kits (Span Diagnostics Ltd, Gujrat, India) as per manufacturer’s instruction. Hepatic triglyceride and cholesterol were measured following the protocol described by other (Matafome et al., 2009).

Statistical analyses

All data are presented as mean ± SEM. Student’s t tests were performed to determine statistical difference between healthy and diseased groups. Statistical significance was considered at P value < 0.05.

Results

Water quality analyses

All the sampled waterbodies were indexed as mesotrophic based on the calculations described by Paulic (1996). The seasonal ranges of the parameters evaluated are summarized in the supplementary table.

Disease symptoms and prevalence

The symptoms observed were: red ventral skin along with warts in some individuals, reddened toes of both fore and hind limb, with more severity in the forelimbs. Fungal assemblage in dorsal and ventral skin of both species along with cysts in the liver of the affected individuals was also observed. Prevalent symptom upon infection of A. alternata among both Hoplobatrachus tigerinus and Phrynoderma hexadactylum is clearly visible from panels of Fig. 2.

Fig. 2

Morphological changes due to Alternaria alternata infection A Redness in ventral region of hind limb of Phrynoderma hexadactylum B Skin redness in Hoplobatrachus tigerinus C Ventral skin rashes and lesion in Phrynoderma hexadactylum D Growth of A. alternata in dorsal skin of H. tigerinus E Infected liver of H. tigerinus

A total of 1230 individuals (569 males and 661 females) of H tigerinus were screened from the five districts, among which 63 individuals (29 males and 34 females) were found to be carrying disease symptoms. For P hexadactylum, total 1147 (600 males and 547 females) individuals were screened among which 53 individuals (28 males and 25 females) were carrying disease symptoms. The present study did not find any sex bias of disease prevalence. The Snout–Vent length (SVL) range for H tigerinus was 145 mm to 162 mm with a body weight range of 182–210 g (males) and 210–257 g (females). For P hexadactylum, the SVL range was 84–92 mm and 112–128 mm for males and females, respectively. The body weight range was 80–100 g (males) and 108–137 g (females). The sampling was done throughout the year, and it was observed that infection was predominant throughout the year except during the winter season when abundance of animals was seriously very low. The comparative account of disease prevalence is shown in Table 2. On average, disease prevalence among H tigerinus and P hexadactylum was 5.12% and 4.62% in the total surveyed areas of southern West Bengal. Among the five districts surveyed South 24 Parganas was found to carry highest disease prevalence with > 7% of disease symptoms carrying frogs.

Table 2 Comparison of disease prevalence in five districts covered along with disease prevalence percentage in each district

Water quality analyses

The parameter details are given in supplementary Table 1. All the data suggested sampling ponds as mesotrophic in nature.

Identification of disease agent

Culture of SD1 and SD2 was successful only from all of them. These two were further investigated for their identification in the following way.

Morphological characterization

Growth of the fungus was nearly 5–10 mm in diameter per day on PDA medium. The pathogen looked white at first and then turned greyish white and gradually turned dark grey with a whitish margin at the periphery. The fungal colony covered full plate in 7–8 days with a puffy growth. The reverse plate shows completely dark brown to black appearance (Fig. 3A).

Fig. 3

Fungal isolates from PDA cultures from skin swabs and lesions of both H. tigerinus and P. hexadactylum. A Pure culture of A. alternata isolate from skin lesion of frogs B & C Conidium of A. alternata under microscope. D PCR product of ITS-based primers using A. alternata genomic DNA

Microscopical features

Conidiophores were pale brown, cylindrical with monopodial branching, hyphae 70–95 × 5.25–8.75 μm. Conidia were usually solitary, sometimes found in chain, straight or curved, obclavate to ellipsoidal, 6–8 septate, tapering gradually into paler beak. Spores were elongated, conical with septa of variable numbers and sometimes with beak ends, pale brown in colour which did not take any stain (Fig. 3B & C). Micromorphometric details of both spores and conidia are summarized in Table 3.

Table 3 Morphometric details of various parameters of A. alternata under ocular and light microscope

With all the cultural and microscopical characters, the causal agent was identified as Alternaria alternata. Identification was done following the features and characters described by Nagamani et al. (2006), Domsch et al. (1980) and Simmons (2007).

Molecular characterization

PCR-based identification of ITS region also confirmed the agent as A. alternata (Fig. 3D). The DNA sequence is given in Table 4. The sequence has been deposited to GenBank (NCBI) with id no. PP396278.1.

Table 4 Partial ITS DNA sequence of A. alternata as confirmed by dideoxy chain termination method (Sanger sequencing)

Validation of Koch postulates

Three out ten individuals H. tigerinus and five out of ten P. hexadactylum expressed disease symptoms within 10 days of spore swabbing as was described previously (Sect. “Molecular identification of fungus”). Rest of the animals of both species developed symptoms within 17th day of swabbing. Pure cultures were made from these diseased animals specifically from their lesions, and PCR for A. alternata ITS was done from their isolated DNA which confirmed the species as A. alternata.

Histology

Steatosis was the major hepatic pathology found. Infected animals (Fig. 4B & D) were found to have excessive lipid deposition in the liver compared to healthy animals (Fig. 4A & C) of both H. tigerinus and P. hexadactylum (Fig. 4A to D). Tissue damage with signs of local bleeding was predominant in all tissue sections. Replacement of cellular content with fibrous structure was the primary visible finding in lungs with impressions of local bleeding (Fig. 4E). The presence of A. alternata spores in the lungs was a major finding as depicted in Fig. 4F.

Fig. 4

Comparative histological peculiarities upon A. alternata infection to the frogs. A and B TS of normal and infected liver of H. tigerinus. C and D TS of normal and infected liver of P. hexadactylum. Nuclear disintegration as well as lipid deposition in the cells is major cytopathological findings. E TS of infected H. tigerinus lungs with spore of A. alternata. Increased fibrosis in lungs was observed upon infection. F Magnified view of A. alternata spore shown in E

Blood cell count and serum biochemistry

Statistically significant increase was observed in total WBC counts among diseased animals of both frog species evaluated compared to healthy animals. Serum SGPT level increased enormously in diseased animals of both species indicating liver toxicity among them. Serum triglyceride level was also found to be elevated after infection. Supportive to the histological findings hepatic triglyceride content was also found to be increased upon infection. Parameters are summarized in Table 5.

Table 5 Comparison of clinical parameters between healthy and Alternaria alternata infected individuals (n = 10 for each group, 5 males and 5 females) of H. tigerinus and P. hexadactylum

Discussions

It has been reported that the fungus Batrachochytrium dendrobatidis, the causative agent of “Chytridiomycosis”, has significant detrimental effect on several amphibian species among whom the majority were anurans (Fisher & Garner, 2020). Reports (Lips et al., 2006; Rollins-Smith, 2020) for the last 20 years are describing significant global decline of amphibians due to chytridiomycosis. The present study was initiated to identify probable fungal disease(s) of anurans of southern West Bengal, their pathology and prevalence. Samplings were done from waterbodies after evaluation of their “Trophic State Index” as described earlier. Only mesotrophic waterbodies were selected for sampling to avoid any other stress on the sampled animals that can potentially alter their clinical parameters. Vivisection-based morphological examination of internal organs of infected frogs primarily revealed cysts and dysmorphisms in liver. From the results, it seems that metabolic liver damage remains the major causal factor behind death. Highest disease prevalence was found in South 24 Parganas for both the frogs studied but lowest affected districts for H. tigerinus and P. hexadactylum were Nadia and Howrah, respectively. A prevalence range of ~ 3– ~ 7% with a detrimental effect is a major cause of concern from the point of anuran conservation.

These two frogs are known to be palatable delicacy in different part of the world comprising > 400 million USD industry (Gratwicke et al., 2010) for their legs. Therefore, a large number of people are directly exposed to these two frogs in the eastern as well as western part of the globe. Reports of A. alternata as upper respiratory tract allergy causing agent in human (Kurup et al., 2000) are also coming to scientific literature raising the concern. Therefore, thorough and exhaustive survey is the call of the time to determine the actual disease burden among these anurans and other ones in a global scale. The existing IUCN “Red list” status of both H. tigerinus and P. hexadactylum is “Least Concerned” but as per IUCN herself both these species require status update surveys since last evaluations were done in 2008 and 2004, respectively. Therefore, it is very much necessary for the entire scientific world to wake up and take prompt possible action to save our biggest source of natural bioactive components from becoming extinct leading to devastation of the entire ecological balance of the globe.

Fungal diseases have remained cause of concern for all other taxa due to their aggressive adaptability in exploiting organic resources be alive or dead. A. alternata is known to infect over 380 types of fruits and vegetables including apple, Acacia, Antirrhinum, Asclepias, Calathea, Callistephus, Chrysanthemum, citrus, clarkia, Dahlia, Ficus, Hedera, Helianthus, Hibiscus, litchi, Oenothera, passionfruit, pelargonium and petunia, tomato, etc.(Ellis, 1971; Farr et al., 1989; Karunakara Murthy et al., 2003). However, any report regarding A. alternata mediated amphibian damage, infection or disease is scanty in the scientific literature till date. It is a very scientifically important fact that a plant infecting fungus is shifting host in a trans-kingdom way to anurans. Such host shifting may have an underlying inter- or intra-specific competition of A. alternata with other one or may be something more interesting that we do not know.

Conclusion

Decline of frogs due to disease will have severe ecological impacts in study areas. The majority of the study areas are rural in human terms. Therefore, local loss of frogs will definitely result in much higher incidence of arbo-vector-borne diseases due to lesser anuran predation of mosquito larvae. The authors therefore strongly recommend further research to elucidate complete patho-mechanism of Alternariosis in anurans.