Skip to main content

Table 2 The list of primers used for RT-PCR

From: A mechanism underlying the neurotoxicity induced by sodium fluoride and its reversal by epigallocatechin gallate in the rat hippocampus: involvement of NrF2/Keap-1 signaling pathway

Gene Accession no. Gene descriptio Gene symbol Forward Reverse Product size
NM_022698.1 Bcl-2-associated death promoter Bad CAGGCAGCCAATAACAGTCA CCATCCCTTCATCTTCCTCA 100
NM_ 031632 Bax: Bcl-2–associated X protein Bax GACACCTGAGCTGACCTTGG GAGGAAGTCCAGTGTCCAGC 310
NM_016993.1 B-cell /lymphoma 2 Bcl2 GGGATGCCTTTGTGGAACTA CTCACTTGTGGCCCAGGTAT 138
NM_012675.2 Tumor necrosis factor superfamily-2 TNF-α CTCCCAGAAAAGCAAGCAAC CGAGCAGGAATGAGAAGAGG 210
NM_342346.3 Nuclear factor-kB NF-kB CGAGCAGGAATGAGAAGAGG CATCTTCAACATGGCAGACGACGA 130
NM_139194.2 TNF receptor superfamily-6 Fas TGCACCAACCTGCCATCCGT ATTCTGGGTCCGGGTGCAGT 139
NM_022277.1 Cysteine-aspartic proteases 8 Cas8 GCGACAGGTTACAGCTCTCC GCAGCCTCTGAAATAGCACC 180
NM_031632.1 Cysteine-aspartic proteases 9 Cas9 CTGGCCCAGTGTGAATACCT CTCAGTCAACTCCTGGGCTC 233
NM_012922.2 Cysteine-aspartic proteases 3 Cas 3 AGTTGGACCCACCTTGTGAG AGTCTGCAGCTCCTCCACAT 298
NM_017008.3 Glyceraldehde3 phosphate dehydrogenase Gapdh GCCAAGGCTGTGGGCAAGGT GAGCAATGCCAGCCCCAGCA 29
\