Skip to main content

Table 1 Primer pairs used in the current study

From: Biochemical and Histopathological studies on female and male Wistar rats fed on genetically modified soybean meals (Roundup Ready)

Target Sequence(s) Ta °C Amplicon size
35S Promoter Forward primer: 5′ GCTCCTACAAATGCCATCA 3′ 56 °C 195 bp
Reverse primer: 5′ GATAGTGGGATTGTGCGTCA 3′
EPSPS_RUR Forward primer:5′ TGATGT GATATCTCCACTGACG 3′ 60 °C 172 bp
Reverse primer:5′ TGTATCCCTTGAGCCATGTTGT 3′