Table 1 The primer sequences, Alp, E-Cad, Vim, STAT3, and gapdh were purchased from the manufacturer Eurofins Genomics
Gene | Accession number | Forward primer (FW) (5′-3′) and Reverse primer (RV) (5′-3′) | Product size (bp) | |
|---|---|---|---|---|
ALP | Alkaline phosphatase | NM _013059.1 | FW: Ctgctgatcactcccacgttt RV: Gttctcccgttcaccgtccac | 164 |
E-CAD | E-cadherin | NM _031334.1 | FW: Catgccccagtatcgtccc RV: Actcccctcatagtcaaacacc | 136 |
VIM | Vimentin | NM_ 031140.1 | FW: Caaacgaataccggagacagg RV: Agttagcagcttcaagggcaa | 126 |
STAT3 | Signal transducer and activator of transcription 3 | NM_012747.2 | FW: Ggctagacaatatcatcgacct RV: Ttgctgctctcactgaaccg | 154 |
GAPDH | Glyceraldehyde 3-phosphate dehydrogenase | NM_017008.4 | FW: tgccactcagaagactgtgg RV: ggatgcagggatgatgttct | 85 |