Skip to main content

Table 1 The primer sequences, Alp, E-Cad, Vim, STAT3, and gapdh were purchased from the manufacturer Eurofins Genomics

From: The role of epithelial–mesenchymal transition (EMT)-associated genes during gonadogenesis of albino rat

GeneAccession numberForward primer (FW) (5′-3′) and Reverse primer (RV) (5′-3′)Product size (bp)
ALPAlkaline phosphataseNM _013059.1FW: Ctgctgatcactcccacgttt
RV: Gttctcccgttcaccgtccac
164
E-CADE-cadherinNM _031334.1FW: Catgccccagtatcgtccc
RV: Actcccctcatagtcaaacacc
136
VIMVimentinNM_ 031140.1FW: Caaacgaataccggagacagg
RV: Agttagcagcttcaagggcaa
126
STAT3Signal transducer and activator of transcription 3NM_012747.2FW: Ggctagacaatatcatcgacct
RV: Ttgctgctctcactgaaccg
154
GAPDHGlyceraldehyde 3-phosphate dehydrogenaseNM_017008.4FW: tgccactcagaagactgtgg
RV: ggatgcagggatgatgttct
85
\