Skip to main content

Table 1 Primers, their sequence, and application in this study

From: Caspase-8 in Labeo rohita is evolutionary conserved and is activated in Aeromonas hydrophila and Edwardsiella tarda infection and rhabdovirus vaccination

PrimerSequence (5′ → 3′)Application
(a) Primers used for PCR amplification and cloning of rohu caspase-8
 Casp8-FW#CCAGCTGAAGTTTCTGTGCCloning
 Casp8-RV#CCGAGATTGTCTTCTGTCATGTC
 Casp8-FW#AMTATCTGAAGACATGACAGAAGA
 Casp8-RV#CCCS TAGAGGR AGTCTGCCTCCT
 Casp8-FW*GGGCACAGTGTTGGGTATTGAT
 Casp8-RV*GTGCTCTACTGTGGCCATTCCTA
 GSP-RV-5′CCTTGTTCCTGGGCCCTGTAGTCCTGTATCCT5′ RACE
 GS-NP-RV-5′GAGGCGTCACGTTGTTGCAGATTTCTTTCCAC5′ Nested RACE
 GSP-FW-3′TGACAAAGGTAAACCATGAAGTGAGCT3′ RACE
 GS-NP-FW-3′CAGTGTTGGGTATTGATGCTAAAGAGGTTGA3′ Nested RACE
 UPMLong: CTAATACGACTCACTATAGGGCAAGCAGT
GGTATCAACGCAGAGT
RACE
Short: CTAATACGACTCACTATAGGGC
 NUPAAGCAGTGGTATCAACGCAGAGTNested RACE
(b) Primers used for rohu-caspase-8 gene expression analysis by quantitative real-time PCR (qRT-PCR) assay
 Casp-8 FWGGGCACAGTGTTGGGTATTGATReal-time PCR
 Casp-8 RVGTGCTCTACTGTGGCCATTCCTA
 β-actin FWAGACCACCTTCAACTCCATCATG
 β-actin RVTCCGATCCAGACAGAGTATTTACGC
  1. Primers marked with “#” were designed from the conserved regions of caspase-8 cDNA sequence of Danio rerio (acc. no. AF273220.1), Ctenopharyngodon idella (acc. no. KP145003.1), and Cyprinus carpio (KC822471.1), and primers “*” have been designed from the transcriptome sequence of rohu caspase-8. “M” stands for A/C, “S” for G/C, “R” for A/G nucleotide