Molecular characterization and phylogenetic analysis of collected mosquitoes (Diptera: Culicidae) from Northcentral Nigeria using mitochondrial COI and ribosomal IGS gene regions

The Journal of Basic and Applied Zoology

Table 1 Primer sequences from COI and IGS sequences used for detection of polymorphism in the Mosquito populations

S/No	Gene region	Primer names	Nucleotide sequences (5′–3′)	% GC content	Expected PCR product size (base pairs)	References
1	COI	Forward	GGTCAACAAATCATAAAGATATTGG	32.0	710	Folmer et al., (1994)
2	COI	Reverse	TAAACTTCAGGGTGACCAAAAAATCA	34.6	710	Folmer et al., (1994)
3	Ribosomal DNA IGS	Forward	GTGAAGCTTGGTGCGTGCT	57.9	169	Ajamma et al., (2016a, 2016b)
4	Ribosomal DNA IGS	Reverse	GCACGCCGACAAGCTCA	64.7	169	Ajamma et al., (2016a, 2016b)